View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20943_low_25 (Length: 277)

Name: NF20943_low_25
Description: NF20943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20943_low_25
NF20943_low_25
[»] chr7 (1 HSPs)
chr7 (176-271)||(4523425-4523520)


Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 176 - 271
Target Start/End: Complemental strand, 4523520 - 4523425
Alignment:
176 tattatgaagaaattattgacaatttcaaatcaagttttgctgatgatctacattaaatttgtgaattggctatgatttatttattaccagctgat 271  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||    
4523520 tattatgaagaaattattgacaatttcaaatcaagttttgctgatgatctacatgaagtttgtgaattggctatgatttatttattaccagctgat 4523425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University