View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20943_low_25 (Length: 277)
Name: NF20943_low_25
Description: NF20943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20943_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 88; Significance: 2e-42; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 176 - 271
Target Start/End: Complemental strand, 4523520 - 4523425
Alignment:
| Q |
176 |
tattatgaagaaattattgacaatttcaaatcaagttttgctgatgatctacattaaatttgtgaattggctatgatttatttattaccagctgat |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4523520 |
tattatgaagaaattattgacaatttcaaatcaagttttgctgatgatctacatgaagtttgtgaattggctatgatttatttattaccagctgat |
4523425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University