View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20943_low_29 (Length: 254)
Name: NF20943_low_29
Description: NF20943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20943_low_29 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 34397563 - 34397809
Alignment:
| Q |
1 |
tttaattaacactatgcttgtacgattaaaaattaacacgaaaa-aatgtaatttacttgtaattgaaatatttatgacacatgcgaaagacctgcttgc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34397563 |
tttaattaacactatgcttgtacgattaaaaattaacacgaaaaaaatgtaatttacttgtaattgaaatatttatgacacatgcgaaagacctgcttgc |
34397662 |
T |
|
| Q |
100 |
tatgaagtactgacatggatgctcagacattaacactgataatatttcaaaaattgaatgtaaatacatgtgtcagtattgtgtctcgttgtcgactatg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34397663 |
tatgaagtactgacatggatgctcagacattaacactgataatatttcaaaaattgaatgtaaatacatgtgtcagtattgtgtttcgttgtcgactatg |
34397762 |
T |
|
| Q |
200 |
tcacattctaaacactggatacgtctttaatctgagttatctgtgct |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34397763 |
tcacattctaaacactggatacgtctttaatctgagttatctgtgct |
34397809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 184
Target Start/End: Complemental strand, 40584004 - 40583972
Alignment:
| Q |
152 |
attgaatgtaaatacatgtgtcagtattgtgtc |
184 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
40584004 |
attgaatgtaaacacatgtgtcagtattgtgtc |
40583972 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 149 - 184
Target Start/End: Complemental strand, 40876374 - 40876338
Alignment:
| Q |
149 |
aaaattgaatgtaaat-acatgtgtcagtattgtgtc |
184 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
40876374 |
aaaattgaatgtaaatcacatgtgtcagtattgtgtc |
40876338 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University