View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20943_low_34 (Length: 238)

Name: NF20943_low_34
Description: NF20943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20943_low_34
NF20943_low_34
[»] chr5 (1 HSPs)
chr5 (146-238)||(16699482-16699574)


Alignment Details
Target: chr5 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 146 - 238
Target Start/End: Complemental strand, 16699574 - 16699482
Alignment:
146 gtcaacgaaattatgaagaaagttatgcaaattaacaaatatgattgtttagaattaatgagtttaattttattccttttttacaaataacat 238  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
16699574 gtcaatgaaattatgaagaaagttatgcaaattaacaaatatgattgtttagaattaatgagtttaattttattcctttcttacaaataacat 16699482  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University