View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20943_low_35 (Length: 237)
Name: NF20943_low_35
Description: NF20943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20943_low_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 4e-56; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 88 - 222
Target Start/End: Original strand, 6375761 - 6375895
Alignment:
| Q |
88 |
tgaggatatagttatggaaaagctgctaagccacaccatttatcagttcatnnnnnnnntgtcgttgccacgaccgagactgtgaaaagcggaagtcata |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6375761 |
tgaggatatagttatggaaaagctgctaagccacaccatttatcagttcataaaaaaattgtcgttgccacgaccgagactgtgaaaagcggaagtcata |
6375860 |
T |
 |
| Q |
188 |
ttcataaactcgtcattaacagctgagttaacact |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
6375861 |
ttcataaactcgtcattaacagctgagttaacact |
6375895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 1 - 90
Target Start/End: Original strand, 6374904 - 6374990
Alignment:
| Q |
1 |
tcagtcaactattagagtcactttcatactcagttaacacgattgtaaaataattcttgaatcttatttcatgtacatttagtggtttga |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6374904 |
tcagtcaactattagagtcactttcatactcagttaacacgattgtaaaataattcttgaatcttatt---tgtacatttagtggtttga |
6374990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 6 - 95
Target Start/End: Original strand, 6369985 - 6370074
Alignment:
| Q |
6 |
caactattagagtcactttcatactcagttaacacgattgtaaaataattcttgaatcttatttcatgtacatttagtggtttgaggata |
95 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||| || ||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6369985 |
caactattagagtcacttgcataatcagttaacgcgtctgtgaactaattcttgaatcttatttcatgtacatttagtggtttgaggata |
6370074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University