View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20943_low_37 (Length: 224)
Name: NF20943_low_37
Description: NF20943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20943_low_37 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 78 - 212
Target Start/End: Original strand, 31757621 - 31757759
Alignment:
| Q |
78 |
ccactttttgaagttaattcataaaatgtctcgacaaatatctatttaacatagtttgattggatgcaatgtnnnnnnnnnttaca--atccgtttatag |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| ||||| ||||| |||||| |
|
|
| T |
31757621 |
ccactttttgaagttaattcataaaatgtcttgacaaatatctatttgacatagtttgattggatgcaatgtaaaaaaaatttacattatccgcttatag |
31757720 |
T |
 |
| Q |
176 |
aagtta--attttttgatatgtttgtctcatattcttcg |
212 |
Q |
| |
|
|||||| |||||| |||||||||||||||||| |||| |
|
|
| T |
31757721 |
aagttattttttttttatatgtttgtctcatattattcg |
31757759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 1 - 62
Target Start/End: Original strand, 31757572 - 31757633
Alignment:
| Q |
1 |
aattgtgtaactattttacacatatatttaatcaaatcatttcattatgccactttttgaag |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31757572 |
aattgtgtaactattttacacatatatttaatcaaatcatttcattatgccactttttgaag |
31757633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University