View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20944_high_23 (Length: 250)

Name: NF20944_high_23
Description: NF20944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20944_high_23
NF20944_high_23
[»] chr5 (1 HSPs)
chr5 (127-245)||(12446479-12446597)


Alignment Details
Target: chr5 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 127 - 245
Target Start/End: Original strand, 12446479 - 12446597
Alignment:
127 aatccaagtgctttaccatcttggcaaattgagattgagattctagttacaaataaccaatcacaactaataacttatcattgctaatttttgtgaaaca 226  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||    
12446479 aatccaagtgctttaccatcttggcaaattgagattgagattctagttacaaataaccaatcacaactaataacttatcatagctaatttttgtgaaaca 12446578  T
227 attcataagtaactaaatc 245  Q
    |||||||||||||||||||    
12446579 attcataagtaactaaatc 12446597  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University