View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20944_high_26 (Length: 246)
Name: NF20944_high_26
Description: NF20944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20944_high_26 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 7 - 245
Target Start/End: Complemental strand, 40082425 - 40082184
Alignment:
| Q |
7 |
aatattatgtggtcactccactagttatgtaggatattactattcnnnnnnncttaactaagtattctctacgcacaactgtagagactaatccctcgaa |
106 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40082425 |
aatattatgtcgtcactccactagttatgtaggatattactattctttttttcttaattaagtattctctacgcacaactgtagagactaatccctcgaa |
40082326 |
T |
 |
| Q |
107 |
gatattattgtttgttcccataaactcaagcaaataat---cccaacagttctcattagtatcttcaaccttattggcagcccggacacaagtattttat |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40082325 |
gatattattgtttgttcccataaactcaagcaaataatattcccaacaattctcattagtatcttcaaccttattggcagcccggacacaagtattttat |
40082226 |
T |
 |
| Q |
204 |
tttgaatctcttcatcttataaattttatttctttctaaaaa |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40082225 |
tttgaatctcttcatcttataaattttatttctttctaaaaa |
40082184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University