View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20944_low_28 (Length: 250)
Name: NF20944_low_28
Description: NF20944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20944_low_28 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 115; Significance: 2e-58; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 127 - 245
Target Start/End: Original strand, 12446479 - 12446597
Alignment:
| Q |
127 |
aatccaagtgctttaccatcttggcaaattgagattgagattctagttacaaataaccaatcacaactaataacttatcattgctaatttttgtgaaaca |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12446479 |
aatccaagtgctttaccatcttggcaaattgagattgagattctagttacaaataaccaatcacaactaataacttatcatagctaatttttgtgaaaca |
12446578 |
T |
 |
| Q |
227 |
attcataagtaactaaatc |
245 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
12446579 |
attcataagtaactaaatc |
12446597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University