View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20944_low_29 (Length: 250)
Name: NF20944_low_29
Description: NF20944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20944_low_29 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 13 - 250
Target Start/End: Original strand, 22932406 - 22932643
Alignment:
| Q |
13 |
aatattcatggcaccatagaaaatgatcatacgaattaattggagaaaggaaaagtatcaagaagaagccaactgctcaagtcaatagtggccaaaaatc |
112 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22932406 |
aatattcatggcaccatagaaaatgaccatacgaattaattggagaaaggaaaagtatcaagaagaagccaactgcccaagtcaatagtggccaaaaatc |
22932505 |
T |
 |
| Q |
113 |
aatatgactttgtcatgtttatgatttttccacttcttcattctttaacttctctattcataaatctatatagtacatgcatttggaaaagtagtgttat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22932506 |
aatatgactttgtcatgtttatgatttttccacttcttcattctttaatttctctattcataaatctatatagtacatgcatttggaaaagtagtgttat |
22932605 |
T |
 |
| Q |
213 |
gaaatcttatcatatagtcattccatattttgtcacac |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22932606 |
gaaatcttatcatatagtcattccatattttgtcacac |
22932643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University