View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20944_low_36 (Length: 220)
Name: NF20944_low_36
Description: NF20944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20944_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 19 - 205
Target Start/End: Original strand, 50082796 - 50082982
Alignment:
| Q |
19 |
attgcaggacaattaagaaaagacaacacccaccatttatttttggactataaaatataaacctttttccccaagtaagcttattcttatctctggttag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50082796 |
attgcaggacaattaagaaaagacaacacccaccatttatttttggactataaaatataaacctttttccccaagtaagcttattcttatctctggttag |
50082895 |
T |
|
| Q |
119 |
cgaataacattagttgtggagtttgagatgataatctcatttctatatatgtaggtcgattcaattttatgataatcatgtcatttg |
205 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50082896 |
cgaataaaattagttgtgaagtttgagatgataatctcatttctatatatgtaggtcgattcaattttatgataatcatgtcatttg |
50082982 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University