View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20944_low_37 (Length: 219)

Name: NF20944_low_37
Description: NF20944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20944_low_37
NF20944_low_37
[»] chr5 (1 HSPs)
chr5 (20-203)||(33557891-33558086)


Alignment Details
Target: chr5 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 20 - 203
Target Start/End: Complemental strand, 33558086 - 33557891
Alignment:
20 taaatataaaggtgtggtcggatggtacatatataaaaatgggtcattgttaatttaaaagattgaaaaatg-aagnnnnnnnnntattactagtatgtt 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||           ||||||||||||||    
33558086 taaatataaaggtgtggtcggatggtacatatataaaaatgggtcattgttaatttaaaagattgaaaaatgaaaaaaaaataaaaattactagtatgtt 33557987  T
119 agatcggaaattgaatttgtgagtc----------atagagagtaatactaacacctcgcacgg-taaatattggtcttaccaaatatgtatgttg 203  Q
    |||||||||||||||||||||||||          | ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||    
33557986 agatcggaaattgaatttgtgagtcgattatgaatagagagagtaatactaacacctcgcacggttaaatattggtcttaccaaatatgtatgttg 33557891  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University