View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20944_low_37 (Length: 219)
Name: NF20944_low_37
Description: NF20944
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20944_low_37 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 3e-53; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 20 - 203
Target Start/End: Complemental strand, 33558086 - 33557891
Alignment:
| Q |
20 |
taaatataaaggtgtggtcggatggtacatatataaaaatgggtcattgttaatttaaaagattgaaaaatg-aagnnnnnnnnntattactagtatgtt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
33558086 |
taaatataaaggtgtggtcggatggtacatatataaaaatgggtcattgttaatttaaaagattgaaaaatgaaaaaaaaataaaaattactagtatgtt |
33557987 |
T |
 |
| Q |
119 |
agatcggaaattgaatttgtgagtc----------atagagagtaatactaacacctcgcacgg-taaatattggtcttaccaaatatgtatgttg |
203 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
33557986 |
agatcggaaattgaatttgtgagtcgattatgaatagagagagtaatactaacacctcgcacggttaaatattggtcttaccaaatatgtatgttg |
33557891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University