View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20945_low_8 (Length: 267)
Name: NF20945_low_8
Description: NF20945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20945_low_8 |
 | |
|
| [»] scaffold0088 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0088 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 28 - 232
Target Start/End: Original strand, 47269 - 47473
Alignment:
| Q |
28 |
caacggatttgttaaaatctggtcaaaagagtgtgatagaggcatcacttgaatatcttcgagtaaaagcaaagattacggtcagttatcttctctatct |
127 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
47269 |
caacggaattgttaaaatctggtcaagagagtgtgataaaggcatcacttgaatatcttcaagtaaaagcaaagattacggtctgttatcttctctatct |
47368 |
T |
|
| Q |
128 |
aatgtatcatcgacatatttataacgataaagggtctcaaaatgaatcctatcnnnnnnnatatgggtgatttcatcgtaactaagcttcatgtaacctc |
227 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47369 |
aatgaatcatcgacatatttataacgataaagggtctcaaaatgaatcctatctttttttatatgggtgatttcatcgtaactaagcttcatgtaacctc |
47468 |
T |
|
| Q |
228 |
ccttc |
232 |
Q |
| |
|
||||| |
|
|
| T |
47469 |
ccttc |
47473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University