View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20945_low_9 (Length: 238)
Name: NF20945_low_9
Description: NF20945
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20945_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 45654466 - 45654239
Alignment:
| Q |
1 |
cattacttagattctcaaactattaagtgtgtaaatttgttaggactctcttaatgtcctttgatctctagcttttgggatgatattcaactcatttagc |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45654466 |
cattacttaggttctcaaactattaagtgtgtaaatgtgttaggacactcttaatgtcctttgatctttagcttttgggatgatattcaactcatttagc |
45654367 |
T |
 |
| Q |
101 |
atatagtatcaaaactaacttctctttgttggttattatgtttgannnnnnnnnnnctttctatttttcattgattcttctttgagctctctttgttgga |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45654366 |
atatagtatcaaaactaacttctctttattggttattatgtttga-ttttttttttctttctatttttcattgattcttctttgagctctctttgttgga |
45654268 |
T |
 |
| Q |
201 |
atgtttgattcctctttttgattgcctta |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45654267 |
atgtttgattcctctttttgattgcctta |
45654239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University