View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20946_low_19 (Length: 353)
Name: NF20946_low_19
Description: NF20946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20946_low_19 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 17 - 327
Target Start/End: Complemental strand, 5720988 - 5720688
Alignment:
| Q |
17 |
tgttgggcccatatgacgggttcccctctcccaaccaaaatttctttatattagaagtaagaaatcaaatccttaaccactaattttaaggatccaattt |
116 |
Q |
| |
|
||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
5720988 |
tgttgggcccatatggcaggttcccctctcccaaccaaaatttctttatattagaagtaagaaatcaaatccttaacca----------ggatccaattt |
5720899 |
T |
|
| Q |
117 |
tcttaccagttggatcaatacattgttggtattaatataccacttcatgtatgtgcaaaacaaatgaatttataaatgtgacccccaatttataattatt |
216 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5720898 |
tcttaccacttggatcaatacattgttggtattaatataccacttcatgtatgtgcaaaacaaatgaatttataaatgtgacccccaatttataattatt |
5720799 |
T |
|
| Q |
217 |
taagtatttgtgcgattatctggatttgaaaataaaacgatgcctcgaaattattctctccaacgatccaaaagtcgaacttttcatggtatattatact |
316 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5720798 |
taagtatttgtgcgattatctagatttgaaaataaaacgatgcctcgaaattattctctccaacgatccaaaagtcgaacttttcatggtatattatact |
5720699 |
T |
|
| Q |
317 |
accttatgtcg |
327 |
Q |
| |
|
||||||||||| |
|
|
| T |
5720698 |
accttatgtcg |
5720688 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University