View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20946_low_24 (Length: 281)
Name: NF20946_low_24
Description: NF20946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20946_low_24 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 264; Significance: 1e-147; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 264; E-Value: 1e-147
Query Start/End: Original strand, 14 - 281
Target Start/End: Complemental strand, 41066540 - 41066273
Alignment:
| Q |
14 |
agaaaaaatagtactgctgctatgttttagatgagatagaacagtagcagaaaaccaactcatcatgtcaaacaatgcattaaattttcttatcttgttt |
113 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41066540 |
agaaaaactagtactgctgctatgttttagatgagatagaacagtagcagaaaaccaactcatcatgtcaaacaatgcattaaattttcttatcttgttt |
41066441 |
T |
 |
| Q |
114 |
ctcactatctccttgtttccattcatttcttctctaaaccaagaaggtctctctctactttcatggctttcaactttcaactcctcaaattctgtcccta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41066440 |
ctcactatctccttgtttccattcatttcttctctaaaccaagaaggtctctctctactttcatggctttcaactttcaactcctcaaattctgtcccta |
41066341 |
T |
 |
| Q |
214 |
ccactactttctcatcatgggatccaactcacaaaaatccttgcagatgggattatataaaatgttct |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41066340 |
ccactactttctcatcatgggatccaactcacaaaaatccttgcagatgggattatataaaatgttct |
41066273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University