View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20946_low_31 (Length: 205)

Name: NF20946_low_31
Description: NF20946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20946_low_31
NF20946_low_31
[»] chr1 (1 HSPs)
chr1 (21-154)||(25102769-25102902)


Alignment Details
Target: chr1 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 21 - 154
Target Start/End: Original strand, 25102769 - 25102902
Alignment:
21 tgaatggtgctgagatcatcggtgggaactatttaggggctcattgggaatatttcacttctggtttcagcactgatgaaatttgttccaaaaggttggc 120  Q
    ||||||| ||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
25102769 tgaatggagctgagagcatcggtgggaactatttaggggctcattgggaagatttcacttctggtttcagcactgatgaaatttgttccaaaaggttggc 25102868  T
121 atttttgctcttcatttttgtcattgtttcttgt 154  Q
    ||||||||||||||||||||||||||||||||||    
25102869 atttttgctcttcatttttgtcattgtttcttgt 25102902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University