View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20946_low_31 (Length: 205)
Name: NF20946_low_31
Description: NF20946
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20946_low_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 21 - 154
Target Start/End: Original strand, 25102769 - 25102902
Alignment:
| Q |
21 |
tgaatggtgctgagatcatcggtgggaactatttaggggctcattgggaatatttcacttctggtttcagcactgatgaaatttgttccaaaaggttggc |
120 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25102769 |
tgaatggagctgagagcatcggtgggaactatttaggggctcattgggaagatttcacttctggtttcagcactgatgaaatttgttccaaaaggttggc |
25102868 |
T |
 |
| Q |
121 |
atttttgctcttcatttttgtcattgtttcttgt |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
25102869 |
atttttgctcttcatttttgtcattgtttcttgt |
25102902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University