View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20948_high_12 (Length: 249)
Name: NF20948_high_12
Description: NF20948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20948_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 220; Significance: 1e-121; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 15 - 234
Target Start/End: Complemental strand, 6196163 - 6195944
Alignment:
| Q |
15 |
ggtggaacgttttccaagacttggaatttggggtatgggtggaatgggaaaaacaatcattgctaaagtcttgtttgccaagctgtttgcccaatatgat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6196163 |
ggtggaacgttttccaagacttggaatttggggtatgggtggaatgggaaaaacaatcattgctaaagtcttgtttgccaagctgtttgcccaatatgat |
6196064 |
T |
|
| Q |
115 |
catgtctgctttgctaatgcaaaagaatattcacttagtaagcttttctctgagctactaaaggaagaaatttccccatctaatgtaggatctgcatttc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6196063 |
catgtctgctttgctaatgcaaaagaatattcacttagtaagcttttctctgagctactaaaggaagaaatttccccatctaatgtaggatctgcatttc |
6195964 |
T |
|
| Q |
215 |
atatgaggaggctgagaagt |
234 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
6195963 |
atatgaggaggctgagaagt |
6195944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 33 - 234
Target Start/End: Complemental strand, 6071865 - 6071661
Alignment:
| Q |
33 |
acttggaatttggggtatgggtggaatgggaaaaacaatcattgctaaagtcttgtttgccaagctgtttgcccaatatgatcatgtctgctttgctaat |
132 |
Q |
| |
|
||||||||||||||| ||||| || |||||||| |||| ||| || ||||||||||||||||| | ||||| |||||||| || || |||||||||||| |
|
|
| T |
6071865 |
acttggaatttggggcatgggcggtatgggaaagacaaccatcgccaaagtcttgtttgccaaacactttgctcaatatgaccaagtttgctttgctaat |
6071766 |
T |
|
| Q |
133 |
gcaaaagaatattcacttagtaagcttttctctgagctactaaaggaagaaatttccccatctaa---tgtaggatctgcatttcatatgaggaggctga |
229 |
Q |
| |
|
||||||||||||||| | |||||| | |||||||||||||||||||||||| |||| |||||| | |||| |||| ||||||||||||| ||||||| |
|
|
| T |
6071765 |
gcaaaagaatattcagtcagtaagttattctctgagctactaaaggaagaattttctccatctgatgttgtaatatctacatttcatatgagaaggctga |
6071666 |
T |
|
| Q |
230 |
gaagt |
234 |
Q |
| |
|
||||| |
|
|
| T |
6071665 |
gaagt |
6071661 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 26 - 70
Target Start/End: Original strand, 6123758 - 6123802
Alignment:
| Q |
26 |
ttccaagacttggaatttggggtatgggtggaatgggaaaaacaa |
70 |
Q |
| |
|
|||||||| |||||||||||||||||| |||| | |||||||||| |
|
|
| T |
6123758 |
ttccaagaattggaatttggggtatggatggattaggaaaaacaa |
6123802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 33 - 234
Target Start/End: Original strand, 37450828 - 37451032
Alignment:
| Q |
33 |
acttggaatttggggtatgggtggaatgggaaaaacaatcattgctaaagtcttgtttgccaagctgtttgcccaatatgatcatgtctgctttgctaat |
132 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||| |||| |||||| |||||||| |||||||| | |||||||||||||| ||||| |||||||||||| |
|
|
| T |
37450828 |
acttggaatttggagtatgggcggaatgggaaagacaaccattgccaaagtcttttttgccaaacactttgcccaatatgaccatgtttgctttgctaat |
37450927 |
T |
|
| Q |
133 |
gcaaaagaatattcacttagtaagcttttctctgagctactaaaggaagaaatttccccatc---taatgtaggatctgcatttcatatgaggaggctga |
229 |
Q |
| |
|
|||||||||||||||||||| | |||| |||||||||||||||||||||||||||| |||| | |||| |||| || |||||||||||||||||| |
|
|
| T |
37450928 |
gcaaaagaatattcacttagcaggcttctctctgagctactaaaggaagaaatttctgcatccgatgttgtaaaatctacaattcatatgaggaggctga |
37451027 |
T |
|
| Q |
230 |
gaagt |
234 |
Q |
| |
|
||||| |
|
|
| T |
37451028 |
gaagt |
37451032 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University