View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20948_high_9 (Length: 255)
Name: NF20948_high_9
Description: NF20948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20948_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 5546263 - 5546013
Alignment:
| Q |
1 |
acttgcaattatgagaattgatgtatccgttagtgtgattgttcgagaattcgaagttaataaagacaaagaaagagtagaagcagttgaaaggacatgt |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5546263 |
acttgcaattatgagagttgatgtatccgttagtgtgattgttcgagaattcgaagttaataaagacaaagaaagagtagaagcagttgaaaggacatgt |
5546164 |
T |
|
| Q |
101 |
gaagttggacctagtaaccaactttctctcttcaccgacatgcttggtgaccccatttgcagggtccgccactccccttcttacctcatgctggtatata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5546163 |
gaagttggacctagtaaccaactttctctcttcaccgacatgcttggtgaccccatttgcagggtccgccactcaccttcttacctcatgctggtatata |
5546064 |
T |
|
| Q |
201 |
ttcacaaaaatcattcattttcactattctattactttcattcttctctct |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
5546063 |
ttcacaaaaatcattcattttcactattctattacttacattcttctctct |
5546013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 58 - 168
Target Start/End: Original strand, 39917998 - 39918108
Alignment:
| Q |
58 |
taataaagacaaagaaagagtagaagcagttgaaaggacatgtgaagttggacctagtaaccaactttctctcttcaccgacatgcttggtgaccccatt |
157 |
Q |
| |
|
||||||||| | |||||| || ||||||||||||| | ||||||||||||||| ||| | ||||| |||||||||||| ||| |||||||| ||| |
|
|
| T |
39917998 |
taataaagatagagaaagtgttgaagcagttgaaaaaatatgtgaagttggacccagtggtaagctttccctcttcaccgacttgcacggtgaccctatt |
39918097 |
T |
|
| Q |
158 |
tgcagggtccg |
168 |
Q |
| |
|
||||| ||||| |
|
|
| T |
39918098 |
tgcagagtccg |
39918108 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University