View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20948_low_1 (Length: 609)
Name: NF20948_low_1
Description: NF20948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20948_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 15 - 289
Target Start/End: Complemental strand, 6818473 - 6818208
Alignment:
| Q |
15 |
actcaccgtctgcgggggtgtcttttccatatggttgacctcaagttccacctatatacttgattattcaatgactccaatgttgctgtccacgagtttg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| || ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6818473 |
actcaccgtctgcgggggtgtcttttccatatggttgacctgaagttctac----atacttgattattcaatgactccaatgttgctgtccacgagtttg |
6818378 |
T |
 |
| Q |
115 |
gacttaggatacttacattcaatttaaccgatgaaacaaacttgggcacgtaatgatttaatggctaaggtattgtgattgtgaggtagatggtcacaat |
214 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
6818377 |
gactttggatacttacattaaatttaaccgatgaaacaaacttgggcacgtaatgatttaatggctaaggt------attgggaggtagatggtcacaat |
6818284 |
T |
 |
| Q |
215 |
ctatcccatcagactggaattttttcttg-gcaagccatcaaactggacttaattataaggtgattgcattaagtt |
289 |
Q |
| |
|
|||||||||| ||||||||||||| |||| ||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
6818283 |
ctatcccatctgactggaatttttgcttgagcaagccatcaaactggacttaattgtaaggtgattgaattaagtt |
6818208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 123; E-Value: 7e-63
Query Start/End: Original strand, 92 - 289
Target Start/End: Complemental strand, 6808206 - 6808012
Alignment:
| Q |
92 |
caatgttgctgtccacgagtttggacttaggata--cttacattcaatttaaccgatgaaacaaacttgggcacgtaatgatttaatggctaaggtattg |
189 |
Q |
| |
|
|||||||||| ||||||||||||| ||| ||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6808206 |
caatgttgctttccacgagtttgggctttggatagacttacattgaatttaaccgatgaaacaaacttgggcacgtaatgatttaatggctaaggt---- |
6808111 |
T |
 |
| Q |
190 |
tgattgtgaggtagatggtcacaatctatcccatcagactggaattttttcttg-gcaagccatcaaactggacttaattataaggtgattgcattaagt |
288 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| ||||||||||||| |||| ||||||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
6808110 |
--attgggaggtagatggtcacaatctatcccatctgactggaatttttgcttgagcaagccatcaaactggacttaattgtaaggtgattgaattaagt |
6808013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000009
Query Start/End: Original strand, 17 - 49
Target Start/End: Complemental strand, 6808276 - 6808244
Alignment:
| Q |
17 |
tcaccgtctgcgggggtgtcttttccatatggt |
49 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
6808276 |
tcaccggctgcgggggtgtcttttccatatggt |
6808244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University