View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20948_low_17 (Length: 242)
Name: NF20948_low_17
Description: NF20948
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20948_low_17 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 136 - 242
Target Start/End: Original strand, 44708658 - 44708765
Alignment:
| Q |
136 |
ctcctacggtatcctt-tgacgcccttgaatacacttattttataatcggaagtgcatgtatttgacttttttagattgttatagactttgaactataca |
234 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
44708658 |
ctcccacggtatccttgtgacgcccttgaatacacttattttataatcggaagtgcatgtatttgacttttttagattgttatagacttcgagctataca |
44708757 |
T |
|
| Q |
235 |
tctctctt |
242 |
Q |
| |
|
|||||||| |
|
|
| T |
44708758 |
tctctctt |
44708765 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 88
Target Start/End: Original strand, 44708522 - 44708610
Alignment:
| Q |
1 |
cgtgagtagaataacgcagagttcgcgctttcagatttacgttagtgcatccaaactaactcaa-ctgtccttctttgtcccacttcat |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
44708522 |
cgtgagtagaataacgcagagttcgcgctttcagatttgcgttagtgcatccaaactaactcaaccggtccttctttgtcccacttcat |
44708610 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University