View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20949_high_3 (Length: 409)
Name: NF20949_high_3
Description: NF20949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20949_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 374; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 374; E-Value: 0
Query Start/End: Original strand, 1 - 394
Target Start/End: Original strand, 34331596 - 34331989
Alignment:
| Q |
1 |
cgaggttcattttgtttggactttagagtataatgcaagtgttgtttatgatgataaattagacaagtcttgcagtgatatttcccatcacgaacgtggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34331596 |
cgaggttcattttgtttggactttagagtataatgcaagtgttgtttatgatgataaattagacaagtcttgcagtgatatttcccatcacgaacgtggc |
34331695 |
T |
 |
| Q |
101 |
aaaccctttaattttgcctaggcatgaccatgatgattgatgatcaaaactcagtcactcactcatgaatgatcaaaaattgatacatcgttacaatttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34331696 |
aaaccctttaattttgcctaggcatgaccatgatgattgatgatcaaaactcactcactcatgaatgaatgatcaaaaattgatacatcgttacaatttt |
34331795 |
T |
 |
| Q |
201 |
gttttgttgcacttgcacatgcatgatgcacatgaccttatagcttaattaaagcttgcaacattggtgctactagcttgatcacgcttcctactaatac |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34331796 |
gttttgttgcacttgcacatgcatgatgcacatgaccttatagcttaattaaagcttgcaacattggtgctactagcttgatcacgcttcctactaatac |
34331895 |
T |
 |
| Q |
301 |
aagatttcttgatatgtcactgtggggtcactcaccctttgcttgatagaaggaaaaatagaaagccttcaccaatgaggcaccattttgtatg |
394 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34331896 |
aagatttcttgatatgtcactgtggggtcacccaccctttgcttgatagaaggaaaaatagaaagccttcaccaatgaggcaccattttgtatg |
34331989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University