View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20949_high_4 (Length: 362)
Name: NF20949_high_4
Description: NF20949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20949_high_4 |
 | |
|
| [»] scaffold0631 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0631 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: scaffold0631
Description:
Target: scaffold0631; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 182 - 358
Target Start/End: Complemental strand, 6433 - 6257
Alignment:
| Q |
182 |
tatgagaaagttattttttacgttgctggttacaaatcaatttgcgcagccagaggtagtatggtctaatacatggcagaatctaagtgatgatatagtg |
281 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6433 |
tatgagaaagttatttgtcacgttgctggttacaaatcaatttgtgcagccagaggtagtatggtctaagacatggcagaatctaagtgatgatatagtg |
6334 |
T |
|
| Q |
282 |
tattgcaaaagacgcatcttgcgtgttccaggtatatgttttttctgctatcagtgattatattatcctatgcttct |
358 |
Q |
| |
|
||| || |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6333 |
tatcgccaaagacacatcttgcgtgttccaggtatatgttttttctgctatcagtgattatattatcttatgcttct |
6257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 83 - 142
Target Start/End: Original strand, 923830 - 923889
Alignment:
| Q |
83 |
ctcatttaaagaggcttgcttcgctttggggttgttcgaagatgacacagagtttattga |
142 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
| T |
923830 |
ctcattcaaagatgcttgcttcgctttggggttgttgggtgatgacaaagagtttattga |
923889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 83 - 142
Target Start/End: Complemental strand, 44705019 - 44704960
Alignment:
| Q |
83 |
ctcatttaaagaggcttgcttcgctttggggttgttcgaagatgacacagagtttattga |
142 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||| | ||||||| |||||||||||| |
|
|
| T |
44705019 |
ctcattcaaagatgcttgcttcgctttggggttgttgggtgatgacaaagagtttattga |
44704960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 87 - 160
Target Start/End: Original strand, 47740022 - 47740095
Alignment:
| Q |
87 |
tttaaagaggcttgcttcgctttggggttgttcgaagatgacacagagtttattgatgccatcaaccaggcatc |
160 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||| || ||||| | |||||||| ||||| || ||||| ||||| |
|
|
| T |
47740022 |
tttaaagaagcttgcttcgctttgggattgttggaggatgataaggagtttatagatgcaattaaccaagcatc |
47740095 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University