View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20949_low_10 (Length: 292)
Name: NF20949_low_10
Description: NF20949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20949_low_10 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 150; Significance: 2e-79; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 123 - 276
Target Start/End: Complemental strand, 34952349 - 34952196
Alignment:
| Q |
123 |
caaaagcaaactcaacatatttcattgataatcaccgattgaatttcagatggagtgtatcataaacttgatgactagcgtatcctaaagaaacttatca |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34952349 |
caaaagcaaactcaacatatttcattgataatcaccgattgaatttcagatggagtgtatcataaacttgatgactagcgtatcctaaagaaacttatca |
34952250 |
T |
 |
| Q |
223 |
taatgtgaaattatagcattaaactcaagattgagagttaagtatactgaatat |
276 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34952249 |
taatgtgaaattatagcatcaaactcaagattgagagttaagtatactgaatat |
34952196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 34952486 - 34952379
Alignment:
| Q |
1 |
gtttggaaggcttaaaaaattcaatatggatggaggcaaagcatggaagcttcattgattcatcatcaatatcaattctacaccaacttcaatttcacac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34952486 |
gtttggaaggcttaaaaaattcaatatggatggaggcaaagcatggaagcttcattgattcatgatcaatatcaattctacaccaacttcaatttcacac |
34952387 |
T |
 |
| Q |
101 |
attctcta |
108 |
Q |
| |
|
|||||||| |
|
|
| T |
34952386 |
attctcta |
34952379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 70
Target Start/End: Complemental strand, 34970341 - 34970272
Alignment:
| Q |
1 |
gtttggaaggcttaaaaaattcaatatggatggaggcaaagcatggaagcttcattgattcatcatcaat |
70 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
34970341 |
gtttggaaggcttaaaaaattcaacatggatggaggcaagccatggaaacttctctgattcatcatcaat |
34970272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University