View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20949_low_12 (Length: 255)
Name: NF20949_low_12
Description: NF20949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20949_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 338113 - 337876
Alignment:
| Q |
1 |
cgattctgatacacataaagttagataattattttgtctttnnnnnnnntaaaagataattattttgactttcttgtatcaatgaagtattttggtaatc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
338113 |
cgattctgatacacataaagttagataattattttgtctttcaaaaaa--aaaagatgattattttgactttcttgta-caatgaagtattttggtaatc |
338017 |
T |
|
| Q |
101 |
acggcttgaaggatgcgttcaggtctaaataatatctgcattgatttaagaatatttaa--gggacaaatacgtcaactttatgtctgaagcagctttga |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
338016 |
acggcttgaaggatgcgttcaggtctaaataatatctgcattgatttaagaatatttaagggggacaaatacgtcaactttatgtctgaagcagctttga |
337917 |
T |
|
| Q |
199 |
gtgcatgtttctcaaataaatgtgacacatccttgtgtttt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
337916 |
gtgcatgtttctcaaataaatgtgacacatacttgtgtttt |
337876 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University