View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20949_low_17 (Length: 202)

Name: NF20949_low_17
Description: NF20949
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20949_low_17
NF20949_low_17
[»] chr3 (1 HSPs)
chr3 (28-187)||(5116513-5116672)


Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 28 - 187
Target Start/End: Complemental strand, 5116672 - 5116513
Alignment:
28 ggagtatgtcgagttttgaacatgatgttggaagatcttgagaatccaccctcacctcgtttgttgaggcttttgatttcatgttattctcgcttatctc 127  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
5116672 ggagtatgtcgagttttgaacatgatgttggaagatcttgagaatccaccctcacctcgtttgttgaggcttttgatttcatgttattctcgtttatctc 5116573  T
128 aaaattacaggttggttgagaagttccatgatcttaagaatggttgaatatgcattttct 187  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
5116572 aaaattacaggttggttgagaagttccatgatcttaagaatggttgaatatgccttttct 5116513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University