View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2094_high_10 (Length: 244)
Name: NF2094_high_10
Description: NF2094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2094_high_10 |
 |  |
|
| [»] scaffold0565 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0565 (Bit Score: 100; Significance: 1e-49; HSPs: 2)
Name: scaffold0565
Description:
Target: scaffold0565; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 24 - 135
Target Start/End: Complemental strand, 715 - 604
Alignment:
| Q |
24 |
gattatgcatgatgtcaatgaagcctttaatccattagtacagaacaaacaagattaaatcaagctactcagtagtaatccattgagaaaaacacaagtg |
123 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
715 |
gattatacatgatgtcaacgaagcctttaatccattagtacaaaacaaacaagattaaatcaagctactcagtagtaatccattgagaaaaacacaagtg |
616 |
T |
 |
| Q |
124 |
gcaatttgaccc |
135 |
Q |
| |
|
|||||||||||| |
|
|
| T |
615 |
gcaatttgaccc |
604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0565; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 197 - 229
Target Start/End: Complemental strand, 546 - 514
Alignment:
| Q |
197 |
cgagtgaaattttttaagaatcaataatgatat |
229 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
546 |
cgagtgaaattttttaagaatcaacaatgatat |
514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University