View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2094_high_12 (Length: 209)
Name: NF2094_high_12
Description: NF2094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2094_high_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 12 - 166
Target Start/End: Original strand, 45047783 - 45047937
Alignment:
| Q |
12 |
ccaagaatatgtgtttttctcctatatatagttgtttgcaatttctcgagcttgatcaaagacgaattgaatgaagcccgtatgaatcttagtagacaat |
111 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
45047783 |
ccaataatatttgtttttctcctatatatagttgtttgcaatttctcgagcttgatcaaagacgaattgaatgaagcccgtatgaatcttagtaggcaat |
45047882 |
T |
 |
| Q |
112 |
attctcatgaatattggccacccaaaattctatccactatgacacttttggattc |
166 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
45047883 |
attctaatgaatattggccagccaaaattctatccactatgacacttttggattc |
45047937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University