View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2094_low_7 (Length: 278)
Name: NF2094_low_7
Description: NF2094
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2094_low_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 132 - 263
Target Start/End: Complemental strand, 46002345 - 46002214
Alignment:
| Q |
132 |
catctaatttaactcgactctagttgaatcgattgaatcatgactagagatctcaccgattcgatattatggtttttgaaatattccttcaatgtattta |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46002345 |
catctaatttaactcgactctagttgaatcgattgaatcatgactagagatctcaccgatttgatattatggtttttgaaatattccttcaatgtattta |
46002246 |
T |
|
| Q |
232 |
cctgaannnnnnncagctacggaacatatggt |
263 |
Q |
| |
|
|||||| ||||||||||||||||||| |
|
|
| T |
46002245 |
cctgaatttttttcagctacggaacatatggt |
46002214 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 13 - 46
Target Start/End: Complemental strand, 46002460 - 46002427
Alignment:
| Q |
13 |
atactgtcggatggttgcaccggttcaactaatt |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
46002460 |
atactgtcggatggttgcaccggttcaactaatt |
46002427 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University