View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20950_high_12 (Length: 320)
Name: NF20950_high_12
Description: NF20950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20950_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 5e-93; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 28 - 216
Target Start/End: Original strand, 53479587 - 53479775
Alignment:
| Q |
28 |
aatgcttgggagttaaggcaaggagatcatttgtcttctatatatcttgtttttattagccattgaaagatttaattctttgattcgtgcatcctcaaat |
127 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53479587 |
aatgcttgagagttaaggcaaggagatcatttgtcttctatatatcttgtttttattagccattgaaagatttaattctttgattcgtgcatcctcaaat |
53479686 |
T |
 |
| Q |
128 |
tttaggtgtataaggattttcaaattagtaatgtttagaattttcctattagagtttgctgatgacacgttgctgctatgtgaaaagag |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||| |||||||| |
|
|
| T |
53479687 |
tttaggtgtataaggattttcaaattagtaatgtttagaattttccttttagagtttgctgatggcacgttgctgctatgagaaaagag |
53479775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 224 - 302
Target Start/End: Original strand, 53479895 - 53479973
Alignment:
| Q |
224 |
cccatttaagtatttgtgtttgtcaattggagataatccaagtaggctgtcaatttttaaccgtgtgattgatagaatt |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53479895 |
cccatttaagtatttgtgtttgtcaattggagataatccaagtaggctgtcaatttttaaccgtgtgattgatagaatt |
53479973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University