View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20950_low_16 (Length: 296)
Name: NF20950_low_16
Description: NF20950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20950_low_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 64 - 286
Target Start/End: Complemental strand, 504038 - 503816
Alignment:
| Q |
64 |
ccataaaattgacctagaaaataaagtataaaaaagttacttttaaaaacttatcaatgccatggtggcatttccctaaattttgtatgccaaacataag |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
504038 |
ccataaaattgacctagaaaataaagtataaaaaagttaattttaaaaacttatcaatgccatggtggcatttccctaaattttgtatgccaaacataag |
503939 |
T |
 |
| Q |
164 |
gaggtaaatgtggccgctgattactccctcattttccgtccccaccatcaaaaatatctcctatctctctattcctcgttgaggactcctttcttgcttt |
263 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
503938 |
gaggtaaatgaggccgctgattactccctcattttccgtccccaccatcaaaaatatctcctatctctctattcctcgttgaggactcttttcatgcttt |
503839 |
T |
 |
| Q |
264 |
ctttgtccatacggatccctatg |
286 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
503838 |
ctttgtccatacggatccctatg |
503816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 18 - 72
Target Start/End: Complemental strand, 504276 - 504222
Alignment:
| Q |
18 |
agattagcttgtgtataatgcaagatttgtcttactcacttgcatgccataaaat |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
504276 |
agattagcttgtgtataatgcaagatttgtctgactcacttgcacaccataaaat |
504222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University