View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20950_low_17 (Length: 294)
Name: NF20950_low_17
Description: NF20950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20950_low_17 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 25 - 294
Target Start/End: Complemental strand, 44561375 - 44561106
Alignment:
| Q |
25 |
gaaagtacaatgcatataatatgagcagaacaaaaaccgtgtgatttgaattcccttttgatttcgggatgtgaacaactgaacatgatttacattttcc |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
44561375 |
gaaagtacaatgcatataatatgagcagaacaaaaaccgtgtgatttgaattcccttttgatttcgggatgtgaacaactgaacatgatttgcattttcc |
44561276 |
T |
 |
| Q |
125 |
ttgctgaatgaatatcaaatgacaatacttgtttcttgtttggactcaaattacaaaacttcaatgaatacttgtgaattcttactaccctgaagttatg |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44561275 |
ttgctgaatgaatatcaaatgacaatacttgtttcttgtttggactcaaattacaaaacttcaatgaatacttgtgaattcttactaccctgaagttatg |
44561176 |
T |
 |
| Q |
225 |
attcttatggagttgcgtacccatcctctaaagattaaaagatctattacgatgttggattttgatggtt |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44561175 |
attcttatggagttgcgtacccatcctctaaagattaaaagatctattacgatgttggattttgatggtt |
44561106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University