View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20952_low_5 (Length: 405)
Name: NF20952_low_5
Description: NF20952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20952_low_5 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 19 - 395
Target Start/End: Original strand, 31280816 - 31281206
Alignment:
| Q |
19 |
tttgtttcatgacatctttaatttttgtacatatcaattccttttgcattttgcccttattttgcaagacaatgctattgtttggtgaactgttgaaaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31280816 |
tttgtttcatgacatctttaatttttttacatatcaattccttttgcatttgccccttattttgcaagacaatgctattgtttggtgaactgttgaaaat |
31280915 |
T |
 |
| Q |
119 |
gaaatgcaagacgatactctttgtttcgattaattagaaatgaaagcatgatcccctgttgaaaataacaaacttgttgattaannnnnnncccnnnnnn |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
31280916 |
gaaatgcaagacgatactctttgtttcgattaattagaaatgaaagcatgatcccctgttgaaaataacaaacttgttgattaatttttttcccaaaaaa |
31281015 |
T |
 |
| Q |
219 |
ntatatttatgcattcgtgaatgtt---------------tacttgtattgtcttgttgtccttattcaacctgccagtatctcatcggattcgaccgag |
303 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31281016 |
atatatttatgcattcgtgaatgttgacttgtcttgaaccaacttgtattgtcttgttgtccttattcaacctgccagtatctcatcggattcgaccgag |
31281115 |
T |
 |
| Q |
304 |
ttttggatgaggtttttgatccnnnnnnntgactcagcctaatattagagtcgagattgggttacttgcaataccatctaacccatcctttg |
395 |
Q |
| |
|
||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
31281116 |
tttaggatgaggtttttgatccaaaaaaatgactcagcctaatattagagtcgagattgggttacttgcaataccatc-aacccatcctttg |
31281206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University