View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20952_low_9 (Length: 264)
Name: NF20952_low_9
Description: NF20952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20952_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 16 - 253
Target Start/End: Original strand, 22233269 - 22233506
Alignment:
| Q |
16 |
cttcaatccaaggatttatctgcaatgtctccataattatctgcagcaacatctctccttgaacacctttacaaccttgcaaagacaaacatttcaagct |
115 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22233269 |
cttcaatccaaggatttatctgaagtgtctccataattgtctgcagcaacatctctccttgaacacctttacaaccttgcaaagacaaacatttcaagct |
22233368 |
T |
 |
| Q |
116 |
agcattcttctctaagctcttaaagatcttaacaaaatcatctggtttcaaactctcatcatcatgtatcccgaaccgcgtcacagtctcattcgttact |
215 |
Q |
| |
|
||||||||||||||| ||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22233369 |
agcattcttctctaaactcttgaagattttaacaaaatcatctggtttcaaactctcatcatcatgtatcccgaaccgcgtcaccgtctcattcgttact |
22233468 |
T |
 |
| Q |
216 |
agaaactgtgttatagctactaaaccatcccttcctat |
253 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22233469 |
aaaaactgtgttatagctactaaaccatcccttcctat |
22233506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University