View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20953_high_2 (Length: 219)
Name: NF20953_high_2
Description: NF20953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20953_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 16 - 178
Target Start/End: Complemental strand, 6611409 - 6611247
Alignment:
| Q |
16 |
atgaatgacaacttatagattactccctttgtcccattttaataatcgttttaagttttgcgcagttcttnnnnnnntagttagtttagttgatttcaat |
115 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||| |
|
|
| T |
6611409 |
atgaatgacaacttatagattaccccctctgtcccattttaataatcgttttaagttttgcgcagttcttacaaaaataattagtttagttgatttcaat |
6611310 |
T |
 |
| Q |
116 |
gataaaattagagtcttagataggtggcgcagttgctaaattaatgatctctgacaattgtat |
178 |
Q |
| |
|
||||||||||||||||||||||||||| | ||||| ||||||||||||||||||||||||||| |
|
|
| T |
6611309 |
gataaaattagagtcttagataggtggtgtagttggtaaattaatgatctctgacaattgtat |
6611247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University