View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20953_low_2 (Length: 284)
Name: NF20953_low_2
Description: NF20953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20953_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 46279529 - 46279392
Alignment:
| Q |
1 |
gtagaaacaagctctcaaaaagcaaaggaacaacattcagatgaagataattctttgttcattatgagcaaatggagtccacctatgatgttcaattctc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46279529 |
gtagaaacaagctctcaaaaagcaaaggaacaacattcagatgaagataattctttgttcattatgagcaaatggagtccacctatgatgttcaattctc |
46279430 |
T |
 |
| Q |
101 |
tcaataaccttcaacaagtaagttcaaattagccatgc |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46279429 |
tcaataaccttcaacaagtaagttcaaattagccatgc |
46279392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 192 - 284
Target Start/End: Complemental strand, 46279336 - 46279244
Alignment:
| Q |
192 |
aatcatgaaattgtttgcagcatcaatttgaacaatttcaccaatccatggaaaaaccttgggaagcatacaacaaccgcatttaattaacat |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46279336 |
aatcatgaaattgtttgcagcatcaatttgaacaatttcaccaatccatggaaaaaccttgggaagcatacaacaaccgcatttaattaacat |
46279244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University