View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20953_low_3 (Length: 219)

Name: NF20953_low_3
Description: NF20953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20953_low_3
NF20953_low_3
[»] chr7 (1 HSPs)
chr7 (16-178)||(6611247-6611409)


Alignment Details
Target: chr7 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 16 - 178
Target Start/End: Complemental strand, 6611409 - 6611247
Alignment:
16 atgaatgacaacttatagattactccctttgtcccattttaataatcgttttaagttttgcgcagttcttnnnnnnntagttagtttagttgatttcaat 115  Q
    ||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||       || ||||||||||||||||||||    
6611409 atgaatgacaacttatagattaccccctctgtcccattttaataatcgttttaagttttgcgcagttcttacaaaaataattagtttagttgatttcaat 6611310  T
116 gataaaattagagtcttagataggtggcgcagttgctaaattaatgatctctgacaattgtat 178  Q
    ||||||||||||||||||||||||||| | ||||| |||||||||||||||||||||||||||    
6611309 gataaaattagagtcttagataggtggtgtagttggtaaattaatgatctctgacaattgtat 6611247  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University