View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20954_high_106 (Length: 233)
Name: NF20954_high_106
Description: NF20954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20954_high_106 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 15 - 183
Target Start/End: Complemental strand, 2630611 - 2630443
Alignment:
| Q |
15 |
cagagaatgtcagtcagaacatcaaacggaagaatcggaagcggcggcggagatgttatggtttcgggcgtgagtgagagagaagtagggacgatgtcat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2630611 |
cagagaatgtcagtcagaacatcaaacggaagaatcggaagcggcggcggagatgttatggtttcgggcgtgagtgtgagagaagtagggacgatgtcat |
2630512 |
T |
|
| Q |
115 |
ttgggtcatcttcttccccgtcgcttctaccctccgccatttctctaaaattagggtttgaattctaaa |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2630511 |
ttgggtcatcttcttccccgtcgcttctaccctccgccatttctctaaaattagggtttgaattctaaa |
2630443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 18 - 158
Target Start/End: Complemental strand, 2634920 - 2634783
Alignment:
| Q |
18 |
agaatgtcagtcagaacatcaaacggaagaatcggaagcggcggcggagatgttatggtttcgggcgtgagtgagagagaagtagggacgatgtcatttg |
117 |
Q |
| |
|
||||||||| |||||||||| ||||||||| ||||||| ||||||||||||||||||||||||| |||||||| ||||||||| ||||||||||||||| |
|
|
| T |
2634920 |
agaatgtcaatcagaacatcgaacggaagagtcggaagtggcggcggagatgttatggtttcggcggtgagtgacagagaagtaaggacgatgtcatttg |
2634821 |
T |
|
| Q |
118 |
ggtcatcttcttccccgtcgcttctaccctccgccatttct |
158 |
Q |
| |
|
|| |||||||||| ||||||||||| |||||||||||| |
|
|
| T |
2634820 |
gg---tcttcttccctgtcgcttctactgtccgccatttct |
2634783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 181 - 217
Target Start/End: Complemental strand, 2630425 - 2630389
Alignment:
| Q |
181 |
aaaatagggttcgattcaatgccgcagaagaataaca |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2630425 |
aaaatagggttcgattcaatgccgcagaagaataaca |
2630389 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 122 - 175
Target Start/End: Original strand, 748006 - 748061
Alignment:
| Q |
122 |
atcttcttccccgtcgcttctaccctccgccatttctct--aaaattagggtttga |
175 |
Q |
| |
|
|||||| ||| | |||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
748006 |
atcttcctcctcatcgcttctaccctccgccatttctctacaaaattagggtttga |
748061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University