View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20954_high_112 (Length: 222)
Name: NF20954_high_112
Description: NF20954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20954_high_112 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 20 - 209
Target Start/End: Complemental strand, 449368 - 449183
Alignment:
| Q |
20 |
gagatgactcttgtgaaataggtgaatggctacttattgatgcttacattgattctaattatgaaggttcaatgagtgatagaagatctaccgcagaata |
119 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
449368 |
gagatgactcttgtgaaagaggtgaatggctacttatggaggcttacattgattctaattatgaaggttcaatgagtgatagaagatctaccgcaggata |
449269 |
T |
|
| Q |
120 |
ttatatcttcttgtgcgagcatgcatctttttgtttggagggagtaagaaggaaagtgtaatttcttgatcaaatgtcgaggaagaattt |
209 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
449268 |
ttatatcttcttgtgcga----gcatctttttgtttggagggagtaagaaggaaagtgtaatttcttgatcaaatgtcgaggaagaattt |
449183 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University