View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20954_high_114 (Length: 218)
Name: NF20954_high_114
Description: NF20954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20954_high_114 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 51; Significance: 2e-20; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 135 - 206
Target Start/End: Original strand, 15303112 - 15303179
Alignment:
| Q |
135 |
tatttaaaatacttattaattcaaagaaccaaaatcgagcaaattcaaacctcaacaacggtgttctctgct |
206 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
15303112 |
tatttaaaatacttatt----caaagaaccaaaatcgagcaaattcaaacctcaacaacggtgttttctgct |
15303179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University