View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20954_high_116 (Length: 216)
Name: NF20954_high_116
Description: NF20954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20954_high_116 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 175; Significance: 2e-94; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 11 - 193
Target Start/End: Complemental strand, 35862695 - 35862513
Alignment:
| Q |
11 |
gaggagcagagatgtgattaattaaggtgtggtttcttctaattttaattctcttcattgaagtattgaacgtatagagcattgctaatgaattgttatc |
110 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35862695 |
gaggaccagagatgtgattaattaaggtgtggtttcttctaattttaattctcttcattgaagtattgaacgtatagagtattgctaatgaattgttatc |
35862596 |
T |
 |
| Q |
111 |
tttaaccgcaggtagatgttgatgtttaatttaggaagcagacagtgattcctccatgcatatgcagtcattcattagttact |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35862595 |
tttaaccgcaggtagatgttgatgtttaatttaggaagcagacagtgattcctccatgcatatgcagtcattcattagttact |
35862513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 42 - 182
Target Start/End: Complemental strand, 34812198 - 34812054
Alignment:
| Q |
42 |
gtttcttctaattttaattctcttcattgaagtattgaacgta----tagagcattgctaatgaattgttatctttaaccgcaggtagatgttgat-gtt |
136 |
Q |
| |
|
||||||||||||||| |||||||||||||| |||||||||||| |||||||||||||| | |||||||||| ||| |||||| ||||||||| ||| |
|
|
| T |
34812198 |
gtttcttctaatttttattctcttcattgatgtattgaacgtatatgtagagcattgctaagtacttgttatcttcaacagcaggtggatgttgatggtt |
34812099 |
T |
 |
| Q |
137 |
taatttaggaagcagacagtgattcctccatgcatatgcagtcatt |
182 |
Q |
| |
|
||| ||||||| | |||| |||| |||||| |||||||| ||||| |
|
|
| T |
34812098 |
taacttaggaaac-gacaaagattactccatacatatgcaatcatt |
34812054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University