View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20954_high_40 (Length: 379)
Name: NF20954_high_40
Description: NF20954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20954_high_40 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 322; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 1 - 344
Target Start/End: Original strand, 28119152 - 28119492
Alignment:
| Q |
1 |
cggcggaagcagtggaagcccttgtggggcttgcaagtttttgtggaggaagtgtgtgcaagggtgtgtttttgctccatacttcgattcggagcatgga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28119152 |
cggcggaagcagtggaagcccttgtggggcttgcaagtttttgaggaggaagtgtgtgcaagggtgtgtttttgctccatacttcgattcggagcatgga |
28119251 |
T |
|
| Q |
101 |
acaacatactttgcagctgtgcataaagtgtttggggctagcaatgtatccaaactccttcttggcattccaactggtaggaggcttgatgctgcagtct |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28119252 |
acaacacactttgcagctgtgcataaagtgtttggggctagcaatgtatccaaactccttcttggcattccaactggtaggaggcttgatgctgcagtct |
28119351 |
T |
|
| Q |
201 |
ctctttgctatgaagctcaatcaaggttgagagatcctatctatggatgtgttggtcacatcgttgcccttcagcaacaggtaatgtttcgattaatttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28119352 |
ctctttgctatgaagctcaatcaaggttgagagatcctatctatggatgtgttggtcacatcgttgcccttcagcaacaggtaatgtttcgattaatttt |
28119451 |
T |
|
| Q |
301 |
gattttgatcattattagaaattcttgttagaattatagttact |
344 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
28119452 |
gattttgatc---attagaaattcttgttagaattatagttact |
28119492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000009; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 204 - 285
Target Start/End: Complemental strand, 13270561 - 13270480
Alignment:
| Q |
204 |
tttgctatgaagctcaatcaaggttgagagatcctatctatggatgtgttggtcacatcgttgcccttcagcaacaggtaat |
285 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||| |||| ||| ||||||| ||| ||| || | ||||||||||||||||| |
|
|
| T |
13270561 |
tttgttatgaagctcaagcaaggttgagagatcccatctttggttgtgttgctcatatctttactcttcagcaacaggtaat |
13270480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 18 - 96
Target Start/End: Complemental strand, 13270747 - 13270669
Alignment:
| Q |
18 |
gcccttgtggggcttgcaagtttttgtggaggaagtgtgtgcaagggtgtgtttttgctccatacttcgattcggagca |
96 |
Q |
| |
|
|||||||||| || |||||||||||| | ||||||||| | | || ||| ||||||| || ||||||||||||||||| |
|
|
| T |
13270747 |
gcccttgtggcgcgtgcaagtttttgagaaggaagtgtatcccgggatgtatttttgcgccttacttcgattcggagca |
13270669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University