View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20954_high_44 (Length: 366)
Name: NF20954_high_44
Description: NF20954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20954_high_44 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 11 - 305
Target Start/End: Original strand, 19175523 - 19175828
Alignment:
| Q |
11 |
cagagagggaaaaaacagagcaagagatatcctttttggccattctcgtgacccttttcaggaaatccctagtttcttgcgctagtgatgcttctgccat |
110 |
Q |
| |
|
||||||||| ||| |||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19175523 |
cagagagggcaaagacagagcaagagttatcctttttggccattcttgtgacccttttcaggaaatccctagtttcttgcgccagtgatgcttctgccat |
19175622 |
T |
|
| Q |
111 |
ggaaattggtcaccctactaacgtgcgccatcttgcacatgtcacctttgataggtttaatggtttcttgggtttgcctcttgagcttgtacctcaagtc |
210 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19175623 |
ggaaattggtcaccctactaatgtgcgccatcttgcacatgtcacctttgataggtttaatggtttcttgggtttgcctcttgagcttgtacctcaagtc |
19175722 |
T |
|
| Q |
211 |
cccactacacctcccagtgctaggtaggtttgttgctacat-----------tgttcttgtcttttacttgttgccaaattttatgaagcactgacacca |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19175723 |
cccactacacctcccagtgctaggtaggtttgttgctacattgttcttatcatgttcttgtcttttacttgttgccaaattttatgaagtactgacacca |
19175822 |
T |
|
| Q |
300 |
tacacg |
305 |
Q |
| |
|
||||| |
|
|
| T |
19175823 |
gacacg |
19175828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 127 - 189
Target Start/End: Original strand, 36405878 - 36405940
Alignment:
| Q |
127 |
actaacgtgcgccatcttgcacatgtcacctttgataggtttaatggtttcttgggtttgcct |
189 |
Q |
| |
|
||||||||||||||| | || || || || ||||||||||| ||||||||||||||||||||| |
|
|
| T |
36405878 |
actaacgtgcgccatgtcgctcacgttacttttgataggttcaatggtttcttgggtttgcct |
36405940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University