View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20954_low_105 (Length: 239)
Name: NF20954_low_105
Description: NF20954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20954_low_105 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 11 - 206
Target Start/End: Original strand, 703625 - 703818
Alignment:
| Q |
11 |
cacagatattcatccctttatttcaaaccaaacaaatcttaacccatagttgatttatacccaacaacatatatgctta-tatacaaatctctgacaaac |
109 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
703625 |
cacaaatattcatccctttatttcaaaccaaacaaatcttaacccatagttgatttatacccaaca---tatatgctttgtatacaaatctctgacaaac |
703721 |
T |
 |
| Q |
110 |
ttccaaatgcaaaatccttcttctctcttctacggttagtgttagtgccacagagaataacaacaaattgcactcaccctcactcaaggtaatcctt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
703722 |
ttccaaatgcaaaatccttcttctctcttctacggttagtgttagtgccacagagaataacaacaaattgccctcacccccactcaaggtaatcctt |
703818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University