View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20954_low_49 (Length: 358)
Name: NF20954_low_49
Description: NF20954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20954_low_49 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 320; Significance: 1e-180; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 320; E-Value: 1e-180
Query Start/End: Original strand, 1 - 331
Target Start/End: Complemental strand, 31246814 - 31246483
Alignment:
| Q |
1 |
tctaaaactgcattacacacttcacatcactctt-gcttgaatctgcataaaaaactgcacatttttcttattctttcaacaaaccttgatgagtattac |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31246814 |
tctaaaactgcattacacacttcacatcactctttgcttgaatctgcataaaaaactgcacatttttcttattctttcaacaaaccttgatgtgtattac |
31246715 |
T |
 |
| Q |
100 |
aaatgatctcttcctaccaaccaaaaccatgacatgaagattctcaactcaggtatcatcggatatttcattaccggaagacaacaagacaagtctcacg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31246714 |
aaatgatctcttcctaccaaccaaaaccatgacatgaagattctcaactcaggtatcatcggatatttcattaccggaagacaacaagacaagtctcacg |
31246615 |
T |
 |
| Q |
200 |
ttgttgacgtcgacaacattcaaaatgcttctccccgaaactctacgggagatgagaaaggaagagtgtcctctgtgtctgaatgttgtgtggatttgga |
299 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31246614 |
ttgttgacgtcgacaacattcaaaatgcttctccccgaaactctacgggagatgagaaaggaagagtgtcctctgtgtctgaatgttgtgtggatttgga |
31246515 |
T |
 |
| Q |
300 |
tctggagagtgtggttgttgttgttgatgatg |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31246514 |
tctggagagtgtggttgttgttgttgatgatg |
31246483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 31222448 - 31222371
Alignment:
| Q |
1 |
tctaaaactgcattacacacttcacatcactcttgcttgaatctgcat-aaaaaactgcacatttttcttattctttc |
77 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||| |||||||||| | |||||||| ||||||| |
|
|
| T |
31222448 |
tctaaaaccgcattacacacttcacatcactcttgcttgaatccgcataaaaaaactgcgcctttttcttcttctttc |
31222371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 271 - 341
Target Start/End: Complemental strand, 31222149 - 31222079
Alignment:
| Q |
271 |
tctgtgtctgaatgttgtgtggatttggatctggagagtgtggttgttgttgttgatgatgtgaagagaga |
341 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||| | ||||| ||||| |||||||||||| |
|
|
| T |
31222149 |
tctgtgtctgaatgttgtgtggaattggatctggagagtgtggataatgttgatgatggtgtgaagagaga |
31222079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University