View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20954_low_61 (Length: 315)
Name: NF20954_low_61
Description: NF20954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20954_low_61 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 17 - 257
Target Start/End: Original strand, 27329415 - 27329646
Alignment:
| Q |
17 |
atatcatattctatttacttcagattcatagtttgaattattatggtcaacttctcctaaaatgtgatgagttaatacaaagaaaatagactagaggtag |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27329415 |
atatcatattctatttacttcagattcatagtttgaattattatggtcaacttctcctaaaatgtgatgagttaatacaaagaaaatagactagagg--- |
27329511 |
T |
 |
| Q |
117 |
agggaacacgtctatttgctaaatagtactgctctcagacatggacaaatgttgccacaaaagtataaattctgcactcaacaagctggctgttgcagac |
216 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27329512 |
---gaacacgtctatttgctaaatagt---gctctcagaaatggacaaatgttgccacaaaagtataaattctgcactcaataagctggctgttgcagac |
27329605 |
T |
 |
| Q |
217 |
tgtgaagagagaaaggaaagtatattgaatgttgtgctctc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27329606 |
tgtgaagagagaaaggaaagtatattgaatgttgtgctctc |
27329646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University