View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20954_low_64 (Length: 309)
Name: NF20954_low_64
Description: NF20954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20954_low_64 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 205; Significance: 1e-112; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 16 - 232
Target Start/End: Complemental strand, 40942779 - 40942563
Alignment:
| Q |
16 |
aatatcctgcctgcaaacataacaggtggatagatctttattcatgttttcaatctcctaaataaacctatcgaacaaaatcgtgaataaggataagttt |
115 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40942779 |
aatatcctgcctgcaaacataacagttggatagatttttattcatgttttcaatctcctaaataaacctatcgaacaaaatcgtgaataaggacaagttt |
40942680 |
T |
 |
| Q |
116 |
gttccaacattcaatgaaacaaaacctctgatccaaaggatctttaatagaccaccataagtgggaagtatctgcatgattgattgagataataaaacca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40942679 |
gttccaacattcaatgaaacaaaacctctgatccaaaggatctttaatagaccaccataagtgggaagtatctgcatgattgattgagataataaaacca |
40942580 |
T |
 |
| Q |
216 |
agagcttgtctaacttg |
232 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
40942579 |
agagcttgtctaacttg |
40942563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 229 - 288
Target Start/End: Original strand, 40942463 - 40942522
Alignment:
| Q |
229 |
cttgacacccaaaaaaccacagcaaaggatagcatactttgaccctcttagtgcagttta |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
40942463 |
cttgacacccaaaaaaccacagcaaaggatatcatactttgatcctcttagtgcagttta |
40942522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University