View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20954_low_65 (Length: 307)
Name: NF20954_low_65
Description: NF20954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20954_low_65 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 11 - 174
Target Start/End: Original strand, 48828505 - 48828671
Alignment:
| Q |
11 |
ttatactcattcaatataatttaacatcacaccgctctctatttctctttcacaacggtgcacaagggatgtgagtgtcatcca---tttttattccttt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
48828505 |
ttatactcattcaatataatttaacatcacaccgctctctatttctctttcacaacggtgcacaagggatgtgagtgtcatccatttttttttttccttt |
48828604 |
T |
|
| Q |
108 |
taggaaactgtaatttttataaaattaatattctttcttattttcttgtcttaatcgagaaatgctt |
174 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
48828605 |
taggaaactataatttttataaaattaattttctttcttatttttttgtcttaatcgagaaatgctt |
48828671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 218 - 285
Target Start/End: Original strand, 48829351 - 48829418
Alignment:
| Q |
218 |
gaaatatgtagtaggaaattcacactattcttattttataatcactactaaatttgtggacacagtac |
285 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
48829351 |
gaaatatgaagtaggaaattcacactattcttattttataatcactactaaatttgtggacagagtac |
48829418 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University