View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20954_low_66 (Length: 303)
Name: NF20954_low_66
Description: NF20954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20954_low_66 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 158 - 282
Target Start/End: Complemental strand, 41704314 - 41704190
Alignment:
| Q |
158 |
ctagtatctttctgcatcataggtgcattttacacatttgaattttaaaatccgatagggaaaatgttatgaacttgcattttccgcattctaaaatttg |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41704314 |
ctagtatctttctgcatcataggtgcattttacacatttgaattttaaaatccgatagggaaaatgttatgaacttgcattttccgcattctaaaatttg |
41704215 |
T |
 |
| Q |
258 |
gatgtgtaagatttaattttttgtt |
282 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
41704214 |
gatgtgtaagatttaattttttgtt |
41704190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 17 - 118
Target Start/End: Complemental strand, 41704414 - 41704313
Alignment:
| Q |
17 |
atatgatactgcaagaaattgtggtttcattgatggtgttcatcaatgaaagatagaacaatggatagtgttgtcactggtcaaagggaccgtaaggccg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41704414 |
atatgatactgcaagaaattgtggtttcattgatggtgttcatcaatgaaagatagaacaatggatagtgttgtcactggtcaaagggaccgtaaggccg |
41704315 |
T |
 |
| Q |
117 |
ct |
118 |
Q |
| |
|
|| |
|
|
| T |
41704314 |
ct |
41704313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University