View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20954_low_67 (Length: 301)
Name: NF20954_low_67
Description: NF20954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20954_low_67 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 19 - 290
Target Start/End: Complemental strand, 9459541 - 9459273
Alignment:
| Q |
19 |
caaaatagataatgataattgttaaattaaagtattcaaaataaatgttctctttatttgaaacatatgaatatatagttttatttattaatttatataa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9459541 |
caaaatagataatgataattgttaaattaaagtattcaaaataaatgttctctttatttgaaacatatgaatatatagttttatttattaatttatataa |
9459442 |
T |
|
| Q |
119 |
tcactgattttatacttctatnnnnnnnnnntgccgtgcctgccctacaaaaaatataaatggaaattgcagaacttatttgactttcttttcactaaag |
218 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9459441 |
tcactgattttatacttctataaaaaaa---tgccgtgcctgccctacaaaaaatataaatggaaattgcagaacttatttgactttcttttcactaaag |
9459345 |
T |
|
| Q |
219 |
aacgtggttgacttagattctgaactattggagtctgttcaagcatcaatagtcacttcttttgactttctt |
290 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9459344 |
aacgtggttgacttagattctaaactattggagtctgttcaagcatcaatagtcacttcttttgactttctt |
9459273 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University