View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20954_low_77 (Length: 278)
Name: NF20954_low_77
Description: NF20954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20954_low_77 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 17 - 261
Target Start/End: Original strand, 14168380 - 14168624
Alignment:
| Q |
17 |
tctctattggctttgatctctttaattttattccatccaaaaatgttgctcctatgtctagcccttgatacatatgaccattgttgcttcctgatcttaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14168380 |
tctctattggctttgatctctttaattttattccatccaaaaatgtcgctcctatgactagcccttgatacatatgaccattgttgcttcctgatcttaa |
14168479 |
T |
 |
| Q |
117 |
tgttctatcaatcattaactatggttttgatggaggaaaacaatattttatgttgggttattaaaagagtggtgtgtacaaaggaaccaagaactccaaa |
216 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14168480 |
tgttgtatcaatcattaactatggttttgatggaggaaaacaatattttatattgggttattaaaagagtggtgtgtacaaaggaaccaagaactccaaa |
14168579 |
T |
 |
| Q |
217 |
cgagaagacacaggggcgagaaattatgggtatccatgtaggaaa |
261 |
Q |
| |
|
|||||||| ||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
14168580 |
cgagaagatacatgggcgagaaattatggatatccatgtaggaaa |
14168624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University