View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20954_low_77 (Length: 278)

Name: NF20954_low_77
Description: NF20954
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20954_low_77
NF20954_low_77
[»] chr1 (1 HSPs)
chr1 (17-261)||(14168380-14168624)


Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 17 - 261
Target Start/End: Original strand, 14168380 - 14168624
Alignment:
17 tctctattggctttgatctctttaattttattccatccaaaaatgttgctcctatgtctagcccttgatacatatgaccattgttgcttcctgatcttaa 116  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||    
14168380 tctctattggctttgatctctttaattttattccatccaaaaatgtcgctcctatgactagcccttgatacatatgaccattgttgcttcctgatcttaa 14168479  T
117 tgttctatcaatcattaactatggttttgatggaggaaaacaatattttatgttgggttattaaaagagtggtgtgtacaaaggaaccaagaactccaaa 216  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
14168480 tgttgtatcaatcattaactatggttttgatggaggaaaacaatattttatattgggttattaaaagagtggtgtgtacaaaggaaccaagaactccaaa 14168579  T
217 cgagaagacacaggggcgagaaattatgggtatccatgtaggaaa 261  Q
    |||||||| ||| |||||||||||||||| |||||||||||||||    
14168580 cgagaagatacatgggcgagaaattatggatatccatgtaggaaa 14168624  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University